Spiral

The investigator had Liam’s Internet history up on his laptop.

http://www.msnbc.msn.com/

http://www.google.com/

http://www.msnbc.msn.com/

http://gene.genetics.uga.edu/

http://www.msnbc.msn.com/

http://www.letterboxing.org/

http://www.amazon.com/

http://www.rawstory.com/

http://www.nytimes.com/

http://www.msnbc.msn.com/

Jake scanned through the list: MSNBC. Amazon. All mundane entries. Apparently, before you leap off a bridge you read the news and go shopping for a book.

Bullshit.

“A couple of these stand out to me,” said the investigator. He clicked on http://gene.genetics.uga.edu. The page popped up.

“It’s a fungal genetic database,” Jake said. “See? Click on an organism, choose a chromosome, and up comes the genetic sequence.” Jake hit a few keys, and an almost endless string of genetic letters appeared.

GACTAGCCATTTAACGTACCATTACCTA…

“So this is a website he’d go to as part of his work?”

“All the time. He was genetically engineering fungi. Shuffling genes in and out to get what he wanted. That’s what the gardens are about.”

They kept at it, but all of the other websites appeared equally benign. No sites about suicide. Nothing about cancer, or depression, or anything else indicating that Liam was sick or distraught in any way. No sites about God or death or love. Just the normal detritus of the day.

Jake felt trapped, wanted to crawl out of his skin, see it from a different angle. He just couldn’t make it work. He simply could not reconcile the man he knew with the action he’d taken. No one commits suicide out of the blue like that, not without hinting at it first, not without showing some kind of sign. There was something he wasn’t seeing, but what?

Jake looked again around the room. The neat stacks of papers. The notebook on the lab table. The fungi in the gardens of decay. It was Liam’s world. Nothing different than any other day.

He stood over the gardens, stared down at the even rows of squares. He couldn’t escape a small itch, a sense that something was awry.

When it hit him, he couldn’t believe he hadn’t seen it before.

Jake turned to Becraft. “Did you do something with the Crawlers?”

“Crawlers?”

“The ones he used here in the garden. There should be ten or twenty of them. Maybe a few more over there on the table.”

“What are you talking about?”

“MicroCrawlers. They’re little robots-they look sort of like spiders. The devices allowed Liam to tend to thousands of different fungal samples, all by himself. They were like his graduate students.”

“How big?”

“Each is about the size of a fingernail. Your men didn’t take them?”

“No.”

“Maybe when they came earlier? To secure the room?”

“No. No one else has been inside. Nothing was touched.”

“You’re sure.”

“Yes.”

“Well, they’re gone. Someone must have taken them.”

“Why would someone take them? Who else had key access to this room?”

“Just me, Liam, and a couple of my graduate students. I don’t get it. If someone wanted Crawlers, they wouldn’t come here first. They would go to my lab. We’ve got hundreds of them.”

“Could some of yours be missing, too?”

Jake thought it through. “I need to talk to Dave and Joe.”

8

DUFFIELD HALL LOOMED OVER THE ENGINEERING QUAD, A blocky monolith of glass and steel glowing in the darkness. Inside was the Cornell Nanofabrication Facility, or the CNF, as it was known to three decades of students. Jake checked his watch: ten-fifteen p.m. More than twelve hours had passed since they’d discovered Liam’s body.

Jake entered Duffield Hall through double doors on the north end of the building. This led into a huge atrium that extended nearly a hundred yards. On a typical day, sunlight poured though the translucent skylights in the high ceiling above, and students and faculty would be everywhere, chatting, ordering drinks at the coffee stand, and lounging in chairs along the walls. Even at this hour, a handful of students and faculty would typically be about, but tonight the space was eerily quiet, as if life itself had been drained out of the campus with Liam’s death.

To the right was a series of windows opening into the CNF labs. Joe and Dave were inside, looking for any sign of the missing Crawlers and double-checking that their own stocks were untouched. A careful check of Liam’s records, plus information Maggie had given the police about a Crawler funeral, had put the total number missing at thirteen. Jake and his students had been at it for more than six hours, searching for them everywhere, brainstorming about where they could be or why someone would have taken them. Maybe they’d been stolen by undergraduates as a prank, or Liam had locked them away for safekeeping somewhere? So far, they were in the dark.