Handbook of Vanilla Science and Technology

15.1.1 PCR amplification, cloning, and DNA sequencing

Genomic DNA from leaf tissue of the putative hybrid Vanilla from Costa Rica, V. planifolia, V. pompona, and V. tahitensis was isolated by using a modification of the CTAB (hexade-cyltrimethylammonium bromide) procedure (Doyle and Doyle 1987). The leaf tissue was first freeze dried and then 0.3 g of dried tissue was ground to a powder with 100 mg of PVPP in a mortar. CTAB extraction buffer (100 mM Tris-HCl, ph 8.0,1.4 M NaCl, 20 mM EDTA, 1% 2-mercaptoethanol, 2% CTAB) (9 mls) was added to the powder and the mixture transferred to a centrifuge tube. The sample was incubated at 65°C for 1 h, with mixing by inversion every 10 min. The sample was cooled for 10 min and then extracted by inversion for 5 min with an equal volume of chloroform:isoamyl alcohol (24:1, v/v). The sample was centrifuged for 10 min at 3,000 rpm and the aqueous layer was removed to a new tube and incubated with 5 ul of 100 mg/ml RNAse for 30 min at room temperature. The sample was extracted with chloroform:isoamyl alcohol (24:1 v/v) as before, the DNA in the aqueous layer precipitated by adding 2/3 volume of isopropanol and incubated at —20°C overnight. The DNA was collected by centrifugation at 10,000 rpm for 15 min. and dissolved in 300 ul of TE. The DNA was again precipitated by adding 150 ul of 7.5 M ammonium acetate and 900 ul of ethanol, incubated at —20C overnight, and collected by centrifugation. The final DNA pellet was dissolved in 200 ul of TE.

The primers used for amplification of the nuclear 5.8S rDNA gene and the flanking internal transcribed spacer (ITS) regions were 5'TATGCTTAAAYTCAGCGGGT3' and 5'AACA AGGTTTCCGTAGGTGA3' (Cameron 2009). Approximately 0.5 mg of genomic DNA was used per 50 ml PCR reaction, which contained 10 mM Tris-HCl, pH 8.3,50 mM KCl, 1.5 mM MgCl₂, 0.2 mM each dNTP, 20 pmoles each primer, and 1 ml of Taq polymerase. The initial denaturation was conducted at 94°C for 4 min, followed by 30 cycles of 30 s denaturation at 94°C, 30 s annealing at 52°C, and 1 min extension at 72°C, followed by a final extension at 72°C for 10 min. The PCR products were directly cloned into the pGEM-T Easy vector and plasmids from individual transformed colonies were sequenced. GenBank accession numbers for the ITS clones generated in this study are GQ867234 to GQ867274.

The primers used for amplification of the chloroplast psaB gene were 5'ACGC GTCGTATTTGGTTTGGTATTGC3^' and 5^'CAATGCCAATAAAAAGTAACCCATCC3^' (Cameron 2004). The PCR conditions were as described above with an annealing temperature of 60°C. The PCR products were gel purified and sequenced using the amplification primers and one additional primer (5^'ATGACCAATTCCAAAATTAGTTCTATACAT3^' (Cameron 2004). GenBank accession numbers for the psaB clones generated in this study are GQ888507 to GQ888510.

15.1.2 Phylogenetic analysis

The CLUSTAL-X (Thompson et al. 1997) program was used to align DNA sequences. For the ITS analysis, the sequences included the ITS-1, 5.8S rDNA, and ITS-2 regions. For the

phylogenetic analyses, the sequences were trimmed to include only the regions of sequence overlap for all the sequences in the analysis. Phylogenetic analysis was performed with thePAUP* program (version 4.0b10 for Macintosh; Swofford2002). Phylogenetic trees were generated by using the maximum parsimony full heuristic search option set to simple sequence addition, tree-bisection-reconnection (TBR) branch swapping, and MulTrees on, with 1,000 bootstrap replications. Gaps were treated as missing data.

15.1.3 Preparation of vanilla extracts

Ten grams of cured beans were ground and mixed with 100 mL of 40% ethanol and placed in the oven at 60°C overnight. The mix was filtered, brought up to 100 mL and the filtrate was used for HPLC analysis of four flavor components as described previously (Podstolski et al. 2002). This is the standard procedure commonly used in the industry for extraction.

15.2 RESULTS AND DISCUSSION

Natural interspecific hybridization is recognized as an important factor in plant speciation (Soltis and Soltis 2009), and was the origin of many of the world’s crop species (Hancock 1992; Hughes et al. 2007). Humans have intentionally used interspecific hybridization to improve crops, and in some cases have developed new species (Goodman et al. 1987; Lukaszewski and Gustafson 1987). Interspecific, and even intergeneric hybridization, is commonly used in developing new ornamental orchid varieties (Vainstein 2002).